Biology 205 Protein Synthesis Review.

Introduction: Genes have much of their influence on the phenotype because genes often code for proteins. Proteins as discussed in lecture are polymers of amino acids linked together by peptide bonds. The purpose of this exercise is to review basic concepts related to transcription and translation, the two main steps in protein synthesis. You will start with a DNA molecule, use one strand of the DNA as a template strand for transcription. Then you will transcribe the appropriate strand into a transcript RNA, which we will assume is mRNA. The mRNA will then serve as a template from which the resulting polypeptide will be produced via translation.

Learning goals:

 

Procedure. Work in groups of two for this lab. Read through the narrative in part 1, which gives a general overview of protein synthesis. Then for the two DNA strands given in part 2, identify the template strand; transcribe the template strand into a messenger RNA; translate the mRNA into a polypeptide and write the final polypeptide.

Part 1. Basic background.

I. Some big things to remember about transcription:

 

 

A. Typically at least in prokaryotes genes have the following three parts.

First is a promoter region which consists of a special sequence of nucleotides to which the RNA polymerase involved in transcription must attach. RNA polymerase consists of 4 polypeptide chains attached to a smaller polypeptide called a sigma factor. The sigma factor allows the RNA polymerase to recognize two particular sequence of bases which are upstream (before the actual RNA coding region of the gene. In E. coli the most common sequences of bases recognized by the sigma factors are 35 and 10 base pairs upstream from the beginning of the RNA-coding region. These are called the -35 and -10 box respectively. For instance, a common -35 box looks like this: 5' -TTGACA- 3' and the most common -10 box looks like this: 5' -TATAAT- 3'.

The second region then is the RNA-coding region of the gene which is the part of the gene that will be transcribed. It is from this sequence that an RNA transcript is produced. We will assume that we will be producing mRNA, but keep in mind that tRNA and rRNA along with other types of RNA are also produced by transcription.

The third region of the gene is a terminator region (not to be confused with a certain series of movies). Prokaryote terminator regions contain a small region of DNA called a terminator sequence around 20 bp long downstream from the gene. The events involved in termination are not entirely clear. Actually the terminator region is also transcribed (This is not clear in your text) up to the special terminator sequence.

For our purposes we will ignore the promoter and terminator regions for this exercise.

 

 

 

B. DNA is a double stranded molecule. (What's coming up next is a bit confusing so read carefully!)During transcription the mRNA strand grows in the 5' -------> 3' direction much as we saw in DNA replication. Only one strand, the 'nonsense' strand, of the DNA molecule is transcribed.

Which strand will it be if the new mRNA strand is growing 5' ----> 3'? The other DNA strand, the 'sense strand', is not transcribed. Why is this non-transcribed strand called the 'sense strand'?

 

 

C. The resulting RNA is best called a transcript or immature messenger RNA, and we will think of it for now as mRNA. But in eukaryotes, immature messenger RNA is often subdivided into coding regions called exons and non-coding regions called introns.

 

 

II. Big things to remember about translation:

A. Translation involves a complex series of steps at the ribosome. We will discuss these at another time. Recall that termination ends when the ribosome encounters one of three possible stop codons.

B. During translation, the ribosome reads the mRNA in groups of 3 bases called codons. Beginning with the start codon and ending with one of three stop codons. Codons remember are not overlapping and the meaning of each codon can be gotten by means of Dr. Paul's secret genetic code table which has been published in every biology book since the early 1960's. I have attached a copy of the genetic code table for your use.

Note that the genetic code is virtually universal. What are three other properties of the genetic code? See page 254.

C. There are three types of RNA involved in translation:

1. Messenger RNA (mRNA) containing the codons. The codon is a group of three nucleotides in the mRNA. So you can think of the codons as 'words' in a secret message which is decoded at the ribosome, the information used to specify a sequence of amino acids in the polypeptide.

How many possible codons are there? (Hint: there are 4 possible nucleotides at each of the three positions of the codons.

2. Ribosomal RNA (rRNA) which is part of the ribosome and actually serves in part to catalyze the formation of the polypeptide. RNAs that can serve as a catalyst are called ribozymes.

3. Transfer RNA (tRNA) which carries the amino acids necessary for making the polypeptides. The tRNA is a clover-shaped molecule which has a special region called an anticodon. The anticodons pair up with particular codons and in a sense provide the link between the codon and the appropriate amino acid. Not that the start codon codes for methionine or a similar amino acid but the stop codon does not code for an amino acid. Thus there is no tRNA coding for it.

D. During translation the mRNA is read starting at the 5' end to the 3' end, beginning at the start codon. However, just as genes have promoter and terminator regions, mRNA's resulting from transcription have three regions:

First an untranslated leader sequence called the 5' UTR; then the protein coding sequence which typically begins with a start codon and ends with one of several stop codons. Next is an untranslated trailer sequence called the 3' UTR. Additionally in eukaryotes the immature or pre mRNA transcript is divided into coding regions called exons and non coding regions called introns. The introns are removed as part of a post transcriptional editing process and the final mature mRNA is exported to the cytoplasm. Additionally in eukaryotes the mature mRNA has a 5' cap and small leader in its 5' UTR which is essential for ribosome attachment. The 3' UTR, or trailer is modified to have a tail made of 50- 250 adenine containing nucleotides.

E. Each resulting polypeptide resulting from translation begins with met (converted to fmet in prokaryotes) and the initial met is cleaved off as part of editing. However, any methionines in the polypeptide are not removed. once the polypeptide is produced it may be edited through one of a number of postranslational steps. For instance, immature insulin consists of a single amino acid chain that is cleaved to activate the insulin leading to two smaller polypeptide chains connected by disulfide linkages.

 

 

Part 2. Activity: Examine the DNA sequences and do the following exercise:

Sequence A:

5' - ATGGACCGTTACGTCGGCAGATGA - 3'

Sequence B:

5' - TCATGTGCCGACGTAACGGCGGTCCAT -3'

 

1. First which sequence is the appropriate template strand for transcription? Hint: we are ignoring the promoter and termination regions. Remember that translation later on is going to begin with the start codon and terminate when one of the stop codons is encountered. You might have to read your strand from right to left or from left to right to figure out what is going on.

 

 

 

 

 

 

 

2. If need be, write the sequence of nucleotides in the sequence to be transcribed (the sense strand) here from 3' ------> 5' going from left to right. So the triplet in the DNA complementary to the start codon in the RNA will be at your left.

 

 

 

3. Transcribe this DNA strand into an mRNA molecule. Careful! Remember the differences between RNA and DNA in terms of nucleotide base composition. Keep track of the 3' and 5' ends.

 

 

 

 

4. How many codons are there?

 

 

 

 

5. How many amino acids will the resulting polypeptide have?

 

 

 

 

6. Cells know how to do translation, but mechanically we can do translation by means of the genetic code table. The standard table is attached. Just about all species use the same genetic code table with a few minor changes in some bacterial and protists. Examine the standard table and answer the following questions:

a. How many amino acid coding codons are there in the standard genetic code?

b. How many start codons?

c. How many stop codons.

7. Translate the mRNA and write the resulting polypeptide in terms of the standard 3 letter abbreviations for the amino acids. Remember the mRNA is read starting at the 5' end!

 

 

 

 

 

 

 

 

 

 

 

 

 

Mutations.

8. Mutations are heritable changes in the DNA. One important type of mutation is called a point mutation because it involves a change, addition or removal of a single nucleotide base in the DNA.Take the 5th base in your 'nonsense' DNA strand and replace it with another base. Transcribe the resulting DNA into its messenger RNA and write it here:

 

 

 

 

 

 

9. Translate the mRNA. Write the resulting polypeptide here. How does it compare to your original polypeptide?

 

 

 

What you did is a kind of point mutation called a substitution. Point mutations are mutations that involved just a single nucleotide change in the original DNA

 

 

10. Now take the 5th base in your original 'nonsense' DNA strand and either delete it or insert another DNA base right after it. Write you mutated DNA strand here.

 

 

 

11. Transcribe it and write the mRNA here:

 

 

 

 

 

 

12. Attempt to translate the new mRNA. Write the result of translation here.

 

 

 

 

 

 

13. What you have done is simulated a kind of mutation called a frameshift mutation. Which do you think is most likely to be harmful to a cell. a frameshift mutation or a substitution? Explain why.

 

 

 

 

14. An enzyme called PNPase is able to make random RNA sequences in at each position. The probability of a particular nucleotide base being added to the growing nucleic acid chain is roughly equal to the proportion of that base in a solution containing PNPase and the four nucleotides represented as A,U,G,C. Suppose a scientist wants to make small RNA chains to later serve as templates for translation into small random polypeptides. The scientist has a solution where the concentration of nucleotides are in the ratio 1 U : 2 A : 3 C (No G). Note: this illustrates an important techniques used by scientists to help 'decode' the genetic code.

a. If the scientist translates her RNA's using PNPase in a cell free culture with ribosomes, all 20 amino acids and the other necessary components for translation, what amino acids should she find in her polypeptide and in what ratios?

 

 

 

b. How long would the typical polypeptide chain be.? Hint: what determines the end of translation?

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

tRNA's and wobble.

Recall that tRNA's are clover shaped molecules, an example of which is shown here:

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Note that the 3' side of the clover stem has an attachment site for a particular amino acid. At the other side of the molecule is a series of 3 nucleotides, the anticodon which is complementary to a particular codon. You may have learned that the anticodon is complementary to the codon. Thus you might expect that there should be 61 different tRNA's since there are 61 amino acid coding codons. However in the 1950's Francis Crick introduced the wobble hypothesis which proposed that there are fewer than 61 tRNA's. According to this idea, the third base in the tRNA which is at the 5' end of the anticodon is sometimes able to pair up with more than one possible nucleotide at the 3' end of the codon.

 

 

 

 

The general wobble rules are given in this table from Russell:

Nucleotide at 5' end

of anticodon

Can pair with these nucleotides at the 3' end of the codon

G

U or C

C

G

A

U

U

A or G

I(inosine)

A,U, or C

Note that tRNA's can have other nucleotide bases, importantly some anticodons have inosine at the 5' end.

15. Use the wobble rules to answer the following questions.

a. A particular tRNA has the anticodon

3' - AGI - 5'

What amino acid is this tRNA carrying?

 

b. This tRNA can pair with how many codons?

 

 

 

 

c. Another tRNA has the anticodon:

3' - AAU - 5'

a. What amino acid can this tRNA carry?

e. This tRNA can pair with how many codons?